Vsclprot and MEK3 Show Increased Expression Levels in Adult Aedes albopictus Mosquitoes That Produce Diapause Eggs

GUJHS. 2013 May; Vol. 7, No. 1: 36-46.                                                                         Download PDF of this article

Waseem Khaleel

Department of Biology
Georgetown University, Washington, D.C.

Abstract

Photoperiodic diapause is a pre-programmed state of developmental arrest that is essential for the survival of many insect species through harsh winter seasons (Huffaker, 1999). Despite the wide range of insects that undergo photoperiodic diapause, the molecular mechanisms regulating this crucial adaptation are not well understood. The goal of this research is to identify transcriptional elements of diapause regulation in Aedes albopictus. Aedes albopictus, also known as the Asian tiger mosquito, is an outstanding model for diapause research because of its well-documented larval diapause. Moreover, this mosquito is currently the most invasive mosquito species in the world and is of conspicuous public health concern because it is able to transmit a wide variety of arthropod-borne viruses (Gratz, 2004). Ultimately, understanding mechanisms of diapause regulation in A. albopictus may provide the basis of novel approaches to vector control by disrupting the diapause response. To identify genes involved in the diapause response, quantitative RT-PCR was ran on 17 candidate genes. RNA was isolated from heads of mosquitoes maintained under diapause-averting long day conditions and diapause-inducing short day conditions. The results show that two genes exhibit a significant increased expression in the heads of female mosquitoes under diapausing vs. non-diapausing conditions. One gene, Vsclprot, may be involved in neurotransmission. The other gene, MEK3, is likely involved in the immune system regulation (Huang et al., 2003). These results are consistent with previous studies that have implicated immune signaling and neurotransmission as important components of the diapause program.

Introduction

Diapause is a pre-programmed and hormonally controlled state of developmental arrest that occurs across a wide variety of insect species. Insect diapause is an important adaptation that is essential for surviving predictable and unfavorable environmental conditions, which are mostly encountered in late fall and winter. These conditions include coldness, dryness, drought, and reduced food resources (Huffaker, 1999; Andrewartha, 2008).

The first phase of diapause, pre-diapause, can be divided into two stages: induction and preparation. Induction is the first stage of diapause that occurs at a genetically pre-determined stage of life before the onset of the environmentally stressful conditions (Kostal, 2006). To avoid these conditions, insects in the induction stage are responsive to external cues, which are indicators of the approaching winter season. Daylength is the predominant cue for inducing diapause because it acts as an accurate indicator of changing seasonality (Tauber et al., 1986; Danks, 1987).

After the induction phase, insects start the second stage of pre-diapause, the preparation stage (Tauber et al., 1986). By entering into the preparation stage before the arrival of winter and before the onset of low temperatures, the insects are able to store additional energy reserves (Denlinger, 1986; Denlinger, 2002). In addition to energy reserves, cuticle composition may be altered by adding lipids and hydrocarbons to reduce water loss and make the diapausing insects more resistant to desiccation (Denlinger, 1986; Denlinger, 2002).

Following the preparation stage, diapause is initiated. This is when development is halted and metabolism is reduced (Chapman, 1998). This period of lowered metabolism allows the insects to conserve their nutrient stores and to maintain developmental arrest (Kostal, 2006). After maintaining developmental arrest throughout the unfavorable seasonal conditions, token stimuli act to terminate diapause. The stimuli required for terminating diapause could be chilling, where low temperature is required to terminate diapause (Paris and Jenner, 1959; Shakhbazov, 1961).

After the termination of diapause, some insect species initiate post-diapause quiescence. This phase characterizes the period when the insect is ready to continue its development, and potentially reproduce should the conditions become more favorable after diapause termination (Denlinger et al., 2005; Kostal, 2006).

Organisms in diapause experience an amalgam of stressful conditions such as oxidative stress, coldness, drought, and desiccation (Ragland et al., 2010). These stressful conditions require the upregulation of stress response in the diapausing insect (Tauber et al., 1986). As part of the stress response, immunity is also upregulated in diapausing insects. This is important because insects are not usually motile during diapause and are therefore more prone to infection by microbial and viral agents than non-diapausing insects (Resh and Carde, 2003).

According to Bao and Xu (2011), the brain is “the repository of the diapause program”. Being the center of developmental control, the brain is important for the regulation of diapause. In this process, the brain must store information about environmental cues and it must act upon this information to bring a halt in development, maintain the body in a state of depressed metabolism, and bring an end to diapause when conditions are favorable (Schowalter, 2006). As part of this regulatory mechanism, it has been hypothesized that the brain contains a photoperiodic timer to measure light cycles and dark cycles, and distinguish between long days and short days (Andrewartha, 1952; Danilevsky, 1965). In addition to this timer, the brain is also hypothesized to contain a counter to count the number of short days that passed. After interpreting the daylength and using signals integrated from the timer and the counter, the brain will initiate a photoperiodic response if the conditions are met, i.e. if there is a sufficient short daylength (Lounibos and Bradshaw, 1975). Therefore, the brain has been shown to play an important role in regulating and initiating diapause.

Despite having the knowledge of how diapause is regulated in several insect species, the regulatory mechanisms are not necessarily universal (Denlinger et al., 2002; Denlinger, 2008). Contributing to the paucity of information on the regulation of diapause is the lack of a suitable model organism. Therefore, the search for insects that represent a good model for photoperiodic diapause is important (Denlinger et al., 2002).

The Asian tiger mosquito, Aedes albopictus, has proven to be an excellent model for investigating the molecular basis of photoperiodic diapause. This mosquito species can inhabit temperate regions where it experiences photoperiodic diapause and it can also live in tropical regions where it does not experience photoperiodic diapause (Hawley, 1988). Therefore, this wide geographic range allows the comparison of physiological characteristics between the mosquitoes that inhabit the temperate regions and the mosquitoes that inhabit the tropical regions. Such a comparison is essential for studying the diapause response.

The diapausing eggs of A. albopictus have an increased survivorship under desiccation, reduced food resources, and cold stressful conditions relative to non-diapausing eggs (Hanson and Craig, 1994; Sota and Mogi, 1992). In fact, the mosquitoes that produced desiccation-resistant eggs were more likely to become established in novel habitats compared to mosquitoes that did not produce such resistant eggs (Juliano & Lounibos, 2005). Provided all the adaptation capabilities for its diapausing eggs, A. albopictus provides an invaluable model for studying diapause to give us insight about its physiological and evolutionary adaptations. This is important for addressing important issues in the subjects of ecology and evolutionary biology (Danylevich, 2010).

It is important to study diapause in A. albopictus because it is the most invasive mosquito species in the world, as it is found in 28 countries and in all continents but Antarctica (Benedict et al., 2007). It is also a significant disease vector that is capable of transmitting chikungunya, dengue, and West Nile viruses. (Gratz, 2004; Turell et al., 2001). What makes it even a more dangerous disease vector is it being an aggressive daytime biter that feeds on a wide variety of hosts (Gratz, 2004).

Diapause in A. albopictus is photoperiodic wherein short daylength provides a token cue for initiating diapause (Tauber et al., 1986). This token cue is perceived by the photosensitive adult females. In response, adult females that are exposed to short daylength produce diapause eggs after taking a blood meal (Wang, 1966); the diapause eggs are made with more hydrocarbons (Urbanski et al., 2010). This adaptation makes the diapause eggs able to resist desiccation and coldness. Inside the diapause eggs, the pharate first instar larvae is in a developmental arrest (Hawley et al., 1987).

The goal of my project is to identify how the maternal control of diapause in A. albopictus is regulated. In other words, what is the signal that the photosensitive mother uses for directing the ovaries to make diapause eggs under short day exposure? To try to answer this question, the expression levels of head tissue transcripts were examined from adult females, comparing the expression of transcripts of adult females that give rise to diapause eggs (reared under short daylength) to adult females that do not give rise to diapause eggs (reared under long daylength). A significant differential expression of a transcript can indicate its involvement in diapause. Having an understanding of the molecular regulation of diapause in A. albopictus can increase our understanding of diapause especially in attempting to control a mosquito species that poses a public health threat.

Materials and Methods

Suppressive Subtractive Hybridization

Prior to this research project, a suppressive subtractive hybridization cDNA library was constructed from head tissue of female mosquitoes maintained under diapause-inducing short day conditions or diapause-averting long day conditions. The cDNAs were used to isolate 33 expressed sequence tags (ESTs), listed in Table I, that had the potential of being differentially expressed between SD and LD treatments (Urbanski et al., 2010). The primers of the ESTs, which are listed in Table 2, were screened using semi-quantitative RT-PCR to determine whether the primers produced a single, clear amplification product (Table 3). Quantitative RT-PCR (qRT-PCR) was run on the primers that produced a clear product.

Quantitative RT-PCR (qRT-PCR)

Larvae of A. albopictus were collected from tires in the temperate region of Burlington, New Jersey. The larvae were then transferred to the laboratory where they were reared for seven generations. The larvae developed into pupae within a period of 7-9 days. The pupae then developed into adult mosquitoes within a period of 2-4 days.

Equal amounts of adult mosquitoes were reared under SD (8L:16D) and under LD (16L:8D). Three biological replicates were reared for each light treatment with approximately 250 female mosquitoes in each biological replicate. RNA was extracted from the heads of adult female mosquitoes to run the qRT-PCR experiments. These experiments only included adult females because only females can transmit the diapause response to the next generation (maternal diapause) (Mori et al., 1981; Wang, 1966).

After a period of 7-12 days from the emergence of adult females, the females were blood fed on a human host in one day to initiate ovarian development. Forty-eight hours after the bloodmeal, the females were collected from 1-2 pm and stored at -80ºC to prevent RNA degradation.

The heads of the adult mosquitoes were dissected and used to extract RNA using TRI-Reagent and following a standard TRIZOL protocol, which was followed by a DNase treatment with Turbo-DNAfree. After RNA extraction, PCR was ran on the RNA to confirm that there was no DNA contamination. This was followed by checking the RNA integrity with an RNA chip (Bioanalyzer 2100, Agilent Technologies).

To investigate the possibility of differential expression of ESTs between SD and LD adult females, qRT-PCR was ran on the primers that produced a clear amplification product. For each biological replicate, there were three technical replicates. Each reaction of the technical replicates consisted of 1 μl of 50 ng/μl RNA as a template and 3 μl each of the forward and reverse primers at a concentration of 1 mM. Each reaction consisted of a 30 min reverse transcription step at 50°C and 10 min at 95°C, followed by 45 cycles of 30 seconds at 95°C, 1 min at 63°C and 30 seconds at 72°C. A final cycle consisting of 1 min at 95°C, 30 seconds at 55°C, and 30 seconds at 95°C was performed to determine PCR specificity from the dissociation curve. For each primer, the Cycle threshold (CT) value for the biological replicate of each light treatment was determined by averaging the CT value for the three technical replicates (Tech) of that light treatment.

Ribosomal protein L34 served as an endogenous control in all the qRT-PCR reactions. The SD CT value for each experimental gene was subtracted from the obtained CT value for L34 in the SD treatment. The same calculation was carried out for the LD treatment. This was done for each one of the three biological replicates:

Net SD CT value = SD CT value (primer) – SD CT value (L34)

Net LD CT value = LD CT value (primer) – SD CT value (L34)

Each biological replicate had its own Net CT value: 3 for SD and 3 for LD. The Net SD CT value was squared; the same thing was done for the Net LD CT value. The three squared Net SD values were averaged. The same thing was done for the three squared Net LD CT values. Finally, the averaged value obtained for the SD treatment was divided by the averaged value obtained for the LD treatment. The obtained value (X) represents the fold change of the SD treatment relative to the LD treatment:

X= fold change = (averaged value for SD) / (averaged value for LD)

Statistical Analysis

Two-tailed two-sample Wilcoxon rank sum test was used to determine whether the fold changes in the adult females were significantly different than one (P < 0.05), which indicates a differential expression due to the light treatments alone. A fold change larger than one indicates upregulation under SD and a fold change smaller than one means downregulation under LD.

Diapause Check

To confirm that only SD photoperiod resulted in the production of diapause eggs, two cages were raised: one cage under SD and one cage under LD. For each photoperiod, there was a total of approximately 120 males and 120 females. After mating, the females produced eggs that were collected in both light treatments using paper towels as described earlier. The paper towels were collected on three different dates. Then, 90-120 eggs were counted on each paper towel before placing each paper towel in a Petri dish with two thirds of distilled water and larval food. The percentage of hatched eggs for both light treatments was used to measure the diapause response. To ensure that hatching results were not affected by eggs that did not have an embryo and therefore were counted as “hatched,” the already water-soaked paper towels were exposed to a bleach solution for 72 hours. The bleach would clear the chorion of the egg and facilitate determining whether the eggs were embryonated or not. Unembryonated eggs were not taken into account upon counting the percentage of the hatched eggs. The following equation used to measure % hatch:

The % hatch was used as an index for diapause with a large % hatch indicating a small % of diapause; a small % hatch indicates a large % of diapause.

Results

Semi-quantitative RT-PCR

The results of the semi-quantitative RT-PCR indicated that 17 of the 33 tested primer sets produced a single, clear amplification product. The ESTs for the 17 primers are listed in Table 1 with the putative annotation for each EST. These ESTs were used to run qRT-PCR.

Quantitative RT-PCR (qRT-PCR)

Two ESTs were significantly upregulated under diapause-inducing SD conditions in the temperate population of A. albopictus (Figure 1). The first upregulated EST was putatively annotated as VsclProt and had an average fold change value of 1.76, with a range of 1.66 to 1.86 (P= 0.00057). It was significantly different from 1.0; 1.0 means no difference in expression in response to photoperiod. The second upregulated EST was putatively annotated as MEK3 and had an average fold change value of 2.14, with a range of 1.66 to 2.64 (P= 0.024). It was significantly different from 1.0.

Discussion

Over the last 50 years, many research projects have been conducted to study diapause, revealing a significant amount of understanding for the ecological importance of diapause and for the physiological themes that are shared by diapausing insects. Despite many years of research, the molecular basis for diapause regulation in many insect species is still poorly understood (Denlinger, 2008).

This research is carried out on the mosquito species A. albopictus in an attempt to understand more of the molecular components of diapause which should ultimately help in the fight against diseases carried by this vector, an intensely prominent issue in the arena of public health.

The results of this study show that there was a significant upregulation of MEK3 and VsclProt transcripts in the photosensitive female under SD conditions (Figure 1). An upregulation of these transcripts indicates that they constitute significant transcriptional components of the diapause response in A. albopictus. The remaining 15 transcripts did not show any differential expression and no transcripts showed an increased expression under LD conditions.

For the transcripts MEK3 and VsclProt, differential expression was confirmed using qRT-PCR, which was carried out on three biological replicates. Each biological replicate had three technical replicates. There is thus a high degree of certainty in the fold change values obtained for the two transcripts.

The first differentially expressed transcript is MEK3, which is putatively annotated as “immune signaling molecule.” This annotation was confirmed using Tblastx which involves blasting translated nucleotide sequence on a nucleotide sequence database. The database used in NCBI was nr/nt (Nucleotide collection). There was a strong match to dual specificity mitogen-activated protein kinase kinase (MAPKK) in Aedes aegypti, a closely related mosquito species. There was an alignment of 18 segments with a significant range of E-values from 9e^-34 to 1e^-18; % identity ranged from 77% to 93%. In addition, there was a strong match to dual specificity mitogen-activated protein kinase 3 in Culex pipiens, another closely related mosquito species. The match was less significant than that for A. aegypti because there was an alignment of 2 segments only; however, the E-values were still significant and ranged from 8e^-6 to 1e^-5; % identity ranged from 70% to 92%.

In eukaryotes, including insects, protein kinases can be important for signal transduction of the immune system. The catalytic domains of protein kinases have conserved subdomains that fold in a common catalytic core structure (Hanks & Hunter, 1995). Mitogen-activated protein (MAP) kinase pathways involved MAPK, MAPKK, and MAPKKK kinase modules. These kinases are evolutionary conserved and can be involved in development, proliferation, stress response, and immunity (Karin et al., 1997; Kyriakis & Avruch, 2001). In the fruit fly Ceratitis capitata, protein kinases participate in signal transduction in haemocytes upon stimulation with liposacchrides (LPS) (Charalambidis et al., 1995). Additionally, a D. melanogaster MAP kinase was also activated by LPS (Sluss et al., 1996). LPS are polysaccharide molecules that are found in the outer membrane of Gram-negative bacteria such as E. coli; haemocytes are cells that play a large role in the immune system of invertebrates, acting as phagocytes and are found in the hemolymph.

MEK3 is a kinase that has been isolated from A. aegypti mosquitoes exposed to bacteria. In fact, A. aegypti MEK3 kinase (AaMEK3) is reported to be involved in the immune system as it is activated by bacterial LPS, which is similar to the activation of kinases in C. capitata and D. melanogaster. Therefore, MEK3 is involved in antibacterial peptide synthesis in several insects (Chiou et al., 1998). Based on this information, it is hypothesized that an upregulation of MEK3 transcript in the photosensitive female under SD conditions is a signal used by the mother in stimulating diapause eggs to have an increased immune response. This increased immune response may help the eggs evade bacterial infections during diapause as a large number of diapausing insects face a broad range of microbial agents. This makes an active immune response necessary for their survival.

Future experiments are required to test this hypothesis of the need for a vital immune system. To know if MEK3 is important for diapause eggs, western blot analysis may be conducted to measure the levels of the protein expressed by MEK3 transcript. If the hypothesis holds true, there should be more of MEK3 protein in diapause eggs compared to non-diapause eggs. To confirm that MEK3 is involved in immune response, incubating diapause eggs in a medium of E. coli or other bacterial agents should prove less detrimental to diapause eggs in case of increased expression of the MEK3 protein. Finally, an RNAi analysis may be conducted to degrade the MEK3 transcript and determine the response of the diapause eggs to bacterial infections. If the hypothesis is correct then there should be a weaker response when MEK3 is degraded.

The second upregulated transcript is VsclProt, which is putatively annotated as synaptic vesicle protein. This annotation was confirmed using Tblastx; the database used in NCBI was expressed sequence tag (EST). There was a strong match to synaptic vesicle protein in A. albopictus. The match had a significant E-value that ranged from 8e^-14 to 3e^-9, spanning 4 segments; % identity ranged from 91% to 97%. The match was to the protein sequence of synaptic vesicle protein from the oocyte tissue. This sequence was uploaded to the database by Dr. Urbanski from the Armbruster lab which was during her research on transcripts differentially expressed under SD conditions in the oocyte tissue. A match between the head tissue and the oocyte tissue adds further support to the important function of this transcript in diapause eggs. Blasting the longer sequence (sequence in the database uploaded by Dr. Urbanski) resulted in a strong match to synaptic vesicle protein in A. albopictus, which was identified by Crampton et al. (1998); there was a significant E-value of 4e^-45 and a 75% identity.

Crampton et al. identified synaptic vesicle protein in A. albopictus to be encoding 401 amino acids homologous to rat synaptic vesicle protein (SV2), which is a member of the transmembrane transporter family found in neural and endocrine cells. The region of homology included 7 domains and 2 loops (internal cytoplasmic loop, intravesicular loop) (Crampton et al., 1998). As a synaptic vesicle, SV2 stores and releases neurotransmitters, and mediates their transport into synaptic vesicles. SV2 thus plays an important role in presynaptic function, which involves the brain (Halachmi & Lev, 1996).

The brain exerts control over diapause by containing the timer/counter mechanism that determines daylength, and sends signals through the endocrine system to regulate entry into diapause, maintain the body in diapause, and finally bring it out of the arrest in development when conditions are favorable (Danks, 1987; Zaslavski, 1988).

Based on the information presented, it is hypothesized that VsclProt may be part of the signal that results in the production of diapause eggs in A. albopictus. Under SD conditions, it is hypothesized that an increase in the levels of this transcript in the photosensitive female is used by the female in stimulating the ovaries to lay diapause eggs. Another hypothesis is that an increase in the levels of VsclProt aids in equipping diapause eggs with the suitable quantity of components that help them survive the harsh winter conditions, such as increased immune response, increased desiccation resistance, etc.

Future experiments are required to test this hypothesis. To determine if VsclProt is important for diapause eggs, western blot analysis may be carried out to measure the levels of the protein expressed by the VsclProt transcript. If this hypothesis holds true, there should be more of VsclProt protein in diapause eggs compared to non-diapause eggs. In addition, an RNAi analysis may be conducted to degrade the VsclProt transcript and determine the percent of diapause eggs by measuring the percent of hatched eggs. If the hypothesis holds true that VsclProt is important for diapause, then the percent of hatched eggs should be higher under the RNAi treatment, indicating a lower percent of diapause eggs.

A. albopictus mosquitoes pose a substantial health threat because they are able to carry many viruses, including West Nile and dengue viruses. Diapause has been a major factor in the continuous spread of these mosquitoes across the globe and their ability to adapt to various environments. Understanding more about the underlying molecular mechanisms of diapause regulation can be helpful in developing new approaches to pest control. In regards to this research, future experiments disrupting the expression of MEK3 transcript may make the mosquitoes more prone to bacterial infection during diapause, which can be detrimental to their survival. The same logic may be applied to VsclProt since disrupting the expression of this transcript may result in making less diapause eggs or diapause eggs that are less equipped to survive the severe conditions of winter.

Illustrations

Table 1. ESTs that were screened with semi-quantitative RT-PCR are listed alphabetically with the putative annotation for each EST.

EST Putative Annotation
AaHR Steroid hormone receptor homolog gene and Lian-Aa1 retrotransposon protein gene
Ace Acetylcholinesterase gene
ADP ADP ribosylation factor 79 F
ATPcarr ADP/ATP carrier protein
CyclinG Cyclin G
DEAD DEAD box ATP-dependent RNA helicase
Dnaj Chaperone Protein
EIP Ecdysone  Inducible Protein L2
EPtransf Ethanolamine-phosphate Cytidylyltransferase
Esr Esr 1 protein
Glutheta Glutathione-s-transferase theta
GUST Gustatory receptor 43A
HSP Heat Shock Protein
Interapt Interaptin (cell differentiation)
Juve Juvenile hormone-inducible protein
Kynurne Kynurenine aminotransferase
MEK3 Immune signaling kinase
MethcoA Methylglutaconyl-CoA hydratase
Muci Salivary secreted mucin 3
NaCaExchg Potassium-dependent sodium-calcium exchanger
Phosrestin 1 Phosrestin 1 (Arrestin b)
Phosrestin 2 Phosrestin 2 (Arrestin a)
Pkin Protein kinase C inhibitor
PRL Protein tyrosine phosphatase PRL
Prot Protease regulatory subunit 6a
Rhodopsin Rhodopsin (perception of light)
Strwberry Strawberry notch (development of eggs, wings, or legs)
SURF SURF-4 gene and gene encoding seryl-tRNA synthetase
TIF Translation initiation factor 3
Tropmy Tropomyosin invertebrate
Ubiquitin Ubiquitin
Vg-C Vitellogenin C gene
Vsclesort Vesicle protein sorting-associated
Vsclprot Synaptic vesicle protein 2 gene

 

Table 2. ESTs are listed alphabetically with the sequence of the forward and reverse primers for each EST.

 

EST Forward Primer (5’-3’) Reverse Primer (3’-5’)
AaHR GGCGATGGCACAAATGTCCC GCATCCACCCACGCACG
Ace CACCAGGTCCGCTCCAAGAT GCGTTTACCGCCTCGGCTAT
ADP GTGGTGACAGGTGCTGGATG GAACGGAATTGGGGGTTGTCTG
ATPcarr CGATGAGGTCAAGGCTCTGATG CAATTAGTGTGTAGTCCTGGCTG
CyclinG CGGTTGTTCGGTTTCGGAGAG CCGCCAAGTCGCATCCATAAG
DEAD GAAGACAGGTGAAACAGCCAAGC GTGTGTGTGTGGTCCGCTTAC
Dnaj CCTGGAGGTCAATGTGGAGAAG AGTCAGGGAACGCGACGAAG
EcdyL GGCACTGTCGAGTTCTTACATTTAG GTATTTTGAACGCTTATCGCCCA
EPtransf CGACAATCGCCTGGAAGTGAAC GCATCCGTCGCACCAAACTC
Esr CACCGTCTGCGAGGGAG CTTGGCAGCAACCGTTCCATG
Glutheta CAAGGGCACCAACCAGGAG CATTTATTGCCATCCACCCACGAAC
GUST CATCGTCCGGCGAGACTC GGTTTTGGGCTCATGCCTGC
HSP50 GATGGATAGTGCGCCCCTTG GCTAGTTGTTAGATGCCCTTTAC
Interapt CCGTCCGGTTTCCTCACTAC CTGCTGCTGCTTCGACTCC
Juve CACCGAGTGGCGAGCTTATTG GCACATTGCTTCTCTAACGCCC
Kynurne GCGGCTGCCAATAGTCCTG GTGCCCCTGGATAGTGGC
MEK3 CTCCACATCGCAGTTTTACGG GGCTGTCGCATCGTTCGTTAG
MethcoA CGATGAGGGACTTCAGGTTGATC CTCCGCAAACGCCTTCAGTC
Muci CGGGTCGCTGTGTTTGCTTTC CATTTCGGCGAGGGAATCAACC
NaCaExchg CGTAATCGGCCAACGACAGATG CGGCCAAGGGAAGCCAG
Phosrestin1 CACCGCTACGAGAACTCCC GTATCCATTTTGGTGGGGTTGAGAG
Phosrestin2 CAAGAAGTGCTCCCCGAACG GATTTTTCCGGCTGCGGGTAG
Pkin GTCAGTGCTGGAGCGCAG TGGCCTTCTGGACCAACTCC
PRL GCTCTCCTGTCTGCATTTCCC CGGCAACTTTATCCGTGTTTGATGC
Prot GGCTTGAGCTTCTCCGCATC GACTCGCAGCGTAAGGGC
Rhodopsin GATGCGTGAACAGGCCAAGAAG GCTTGATTTCGGCGCTGGTC
Strwberry CGAAACCATCGGCGAGTGG GGCTTCTTTGGCTTGGCTTTTGTG
SURF CGCCGTAACGAAGCTGCTG GGACGTTCCCGAGAGACAC
TIF GAGCGACTGGGAGGAGC CAGCATCCAATGTGTCGGTGTC
Tropmy CTCGCTTCTCAGTGGCATCC CTGCTGCAAACAACACCCACAAG
Ubiquitin GTCCGATAGGGTGCGGC GGCTAAGATCCAAGATAAGGAAGG
Vg-C CCTTCTGTAATACGAGAGCCGAG GCGTGGGTCCCGAGATG
Vsclesort CGGATTGTCCCGACGGAA CCTTGGTCTGTGGCTGGTTC
Vsclprot GACGGGACGGTGGTTGAATC CCCTCTCTTTCTAACAATTTGCCTCG

 

Table 3. ESTs are listed alphabetically with the observed and expected product lengths for each amplification product.

 

EST Expected Length (Basepairs) Observed Length (Basepairs)
AaHR 185 185
Ace 195 195
ADP 195 195
ATPcarr 275 280-300
CyclinG 145 150
DEAD 205 150
Dnaj 370 280-300
EIP 130 130
EPtransf 195 100-120
Esr 180 90-100
Glutheta 120 150
GUST 180 180
HSP50 230 150
Interapt 200 90-100
Juve 160 160
Kynurne 185 200
MEK3 260 300
MethcoA 110 130
Muci 175 200
NaCaExchg 150 150
Phosrestin 1 200 180
Phosrestin 2 255 300
Pkin 160 160
PRL 150 120
Prot 100 120
Rhodopsin 80 100
Strwberry 285 300
SURF 165 150-180
TIF 75 100-110
Tropmy 180 160-170
Ubiquitin 95 95
Vg-C 190 220
Vsclesort 135 135
Vsclprot 205 220

 

Table 4. ESTs that produced a single, clear amplification product are listed with the % identities and E-values. These ESTs were used to run qRT-PCR

 

EST Putative annotation               % Identity  E-value
VsclProt Synaptic vesicle protein 97 8e^-14
ATPcarr ADP/ATP carrier protein 88 7e^-24
Muci Salivary secreted mucin 85 3e^-22
Tropmy Tropomyosin invertebrate 78 7e^-43
Phosrestin 2 Arrestin a (cell cycle arrest) 92 7e^-154
EIP Ecdysone inducible protein 87 9e^-21
AaHR Steroid hormone receptor homolog 82 3e^-15
DEAD DEAD box ATP-dependent RNA helicase 87 3e^-53
MEK3 Immune signaling kinase MEK3 93 93^-34
EPtransf Ethanolamine-phosphate cytidylyltransferase 86 4e^-80
Glutheta Glutathione-s-transferase theta 79 7e^-31
PRL Protein tyrosine phosphatase 83 1e^-33
Rhodopsin Rhodopsin (perception of light) 94 8e^-69
Dnaj Chaperone protein 91 0.0
HSP Heat shock protein 76 7e^-28
Interapt Interaptin (cell differentiation) 87 4e^-5877
Strawberry Strawberry notch (development of eyes, wings, or legs) 77 2e^-19

 

 

 

Figure 1. Fold change values of VsclProt and MEK3 show upregulation under diapause-inducing SD conditions. A fold change on the Y-axis of 1.0 represents no differential expression of the ESTs between SD and LD photoperiods.


References

Andrewartha, H. G. (1952). Diapause In Relation To The Ecology Of Insects. Biological Reviews, 27, 50-107.

Bao, B. & Xu, W. (2011). Identification of gene expression changes associated with the initiation of diapause in the brain of the cotton bollworm, Helicoverpa armigera. BMC Genomics, 12, 224.

Benedict, M.Q., Levine, R.S., Hawley, W.A., & Lounibos, L.P. (2007). Spread of the tiger: Global risk of invasion by the mosquito Aedes albopictus. Vector-borne Zoonotic Dis, 7,  76-85.

Charalambidis, N.D., Zerva C.G., Lambropoulou, M., & Katsoris, G. (1995). Lipopolysacchride-stimulated exocytosis of nonself recognition protein from insect hemocyte depend on protein tyrosine phosphorylation. Eur J Cell Biol, 76, 32-41.

Chiou, J.Y., Huang, S.J., Huang, S.T. & Cho, W.L. 1998. Identification of immune-related protein kinases from mosquito (Aedes aegypti). J Biomed Sci, 5, 120-126.

Crampton, J.M., James, A.A., Wang, Z.H., & Fallon, A.M. (2003). The mosquito dihydrofolate reductase amplicon contains a truncated synaptic vesicle protein gene. Insect Mol Biol, 7,  317-325.

Danilevsky, A. S. (1965). Photoperiodism and seasonal development in insects. Edinburgh, United Kingdom: Oliver and Boyd.

Danks H.V. (1987). Insect Dormancy: An Ecological Perspective. Ottawa, Canada: Biological Survey of Canada.

Denlinger, D.L. (1986). Dormancy in tropical insects. Annual Review of Entomology, 31, 239–264.

Denlinger, D.L. (2002). Regulation of diapause. Annual Review of Entomology, 47, 93-122.

Denlinger, D.L. (2008). Why Study Diapause? Entomological Research, 38, 1-9.

Gratz, N.G. (2004). Critical review of the vector status of Aedes albopictus. Med. Vet. Entomol, 18, 215–227.

Hahn, D.A. & Denlinger, D.L. (2007). Meeting the energetic demands of insect diapause: Nutrient storage and utilization. J Insect Physiol, 53, 760-773.

Halachmi, N. & Z. Lev. (1996). The Sec1 family: a novel family of proteins involved in synaptic transmission and general secretion. J Neurochem, 66, 889-897.

Hanks, S.K. & Hunter, T. (1995). Protein kinases 6: the eukaryotic protein kinase superfamily: kinase (catalytic) domain structure and classification. FASEB J., 9, 576-596.

Hawley, W. (1988). The biology of Aedes albopictus. J. Am. Mosq. Control Assoc, 4, 2-31.

Hawley, W., Reiter, P., Copeland, R., & Pumpuni, C. (1987). Aedes albopictus in North America: Probably introduction in used tires from northern Asia. Science, 236, 1114-1116.

Hegdekar, B.M. (1972). Epicuticular Wax Secretion in Diapause and non-diapause pupae of the Bertha army worm. Annals of the Entomological Society of America, 72, 13-15.

Huffaker, C.B. & Gutierrez, A.P. (1999). Ecological Entomology. John Wiley & Sons, Inc.

Juliano, S.A. & Lounibos, L.P. (2005). Ecology of invasive mosquitoes: effects on resident species and on human health. Ecol Lett, 8, 558-574.

Karin, M., Liu, Z.G. & Zandi, E. (1997). AP-1 function and regulation. Curr. Opin. Cell Biol, 9, 240-246.

Kostal, V. (2006). Eco-physiological phases of insect diapause. J. Insect Physiol 52, 113-127.

Krebs, R.A., & Feder, M.E. (1997). Deleterious consequences of Hsp70 overexpression in Drosophila melanogaster larvae. Cell Stress Chaperones, 2, 60–71.

Kyriakis, J.M. & Avruch, J. (2001). Mammalian mitogen-activated protein kinase signal transduction pathways activated by stress and inflammation. Physiol Rev, 81, 807-869.

Leather, S.R., Walters, K.F.A. & Bale, J.S. (1993). The Ecology of Insect Overwintering. Cambridge: Cambridge University Press.

Lounibos, L.P., & Bradshaw, W.E. (1975). A second diapause in Wyeomyia smithii: seasonal incidence and maintenance by photoperiod. Can. J. Zool, 53, 215–21.

Mori, A., Oda, T., & Wada, Y. (1981). Studies on the egg diapause and overwintering of Aedes albopictus in Nagasaki. Tropical Medicine, 23, 79-90.

Nakagaki, M., Takei, R., Nagashima, E., & T. Yaginuma. (1991). Cell cycles in embryos of the skilworm, Bombyx mori: G2-arrest at diapause stage. Dev. Genes Evol, 200, 223-229.

Paris, O.H., & Jenner, C.E. (1959). Photoperiodic control of diapause in the pitcher-plant midge, Metriocnemus knobi. AAAS Publ.

Pepper, J.H. (1937). Breaking the dormancy in the sugar-beet webworm, L. stkticalis, by means of chemicals. J. Econ. Ent, 30, 380.

Ragland J.G., Denlinger D.L., & Hahn D.A. (2010). Mechanisms of suspended animation are revealed by transcript profiling of diapause in the flesh fly. Proceedings of the National Academy of Sciences of the United States of America, 107, 14909-14914.

Resh, V., & Carde, R. (2003). (3rd ed). Encyclopedia of Insects. Elsevier Science: Academic Press.

 

Saunders, D.S. (1982). (2nd ed). Insects clocks. Pergamon Press, Oxford.

Schowalter, T.D. (2006). Insect Ecology: An Ecosystem Approach. Amsterdam: Elsevier.

Sluss H.K., Han Z, Barrett T., & Davis R.J. (1996). A JNK signal transduction pathway that mediates morphogenesis and an immune response in Drosophila. Genes Dev, 10, 2745-2758.

Sota, T., & Mogi, M. (1992). Survival time and resistance to desiccation of diapause and non-diapause eggs of temperate Aedes (Stegomyia) mosquitoes. Entomol. Exp. Et App, 63,  155-161.

Tauber M.J., Tauber C.A., & Masaki S. (1986). Seasonal adaptations of insects. New York: Oxford University Press.

Turell, M.J., O’Guinn, M.L., Dohn, D.J., & Jones, J.W. (2001). Vector competence of North American mosquitoes (Diptera: Culicidae) for West Nile virus. Journal of Medical Entomology, 38, 130-134.

Urbanski J., Aruda A., & Armbruster, P. (2010). A transcriptional element of the diapause program in the Asian tiger mosquito, Aedes albopictus, identified by suppressive subtractive hybridization. J. Insect Physiol, 56, 1147-1154.

Wang, K. (1966). Observations on the influence of photoperiod on egg diapause in Aedes albopictus. Acta Entomol. Sinica, 15, 75-77.

Xu, W.H., & Denlinger, D.L. (2003). Molecular characterization of prothoracicotropic hormone and diapause hormone in Heliothis virescens during diapause, and a new role for diapause hormone. Insect Molecular Biology, 12, 509-516.

 

Leave a Reply